Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:119 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-17.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCCGTCGAAAAGCGAGCGCCACGGTCCAGCCTGGACCTCTTCGGCGTGAGATGCGC
CGGCCAAGCCGAGCGCGAGCCCTGTTACGAGCCCAAAGCTGGCCCAGCCCCGTGACGG
CTTCATCCAGACCATGGCGCGTCTCCCCCGCATcgtatcacctcggtcgaaacgccgagctttgttgcaatgtaac
ccatttcatggaagcctccaggcaagaatgaagaggtcgccggggtttgtgtcgtgttgcgtgaagcatctcgatgcggtccattgagcgactgcgaagg
gagcgaacATG

    CC1634 --- CC1635


Gene: CC1634     GI: 16125880     BI number: CC1634     GOG: COG2303     Description: oxidoreductase, GMC family
Gene: CC1635     GI: 16125881     BI number: CC1635     GOG: NOG15593     Description: conserved hypothetical protei


  T
G  G
C  A
C  C
 CG         C
 CG       T  C
 GC       C  C
 AT       T  C
|  T       GC
C  C       CG
C  A       GC
C  T      C  A
 GC       G  T
 GC        Gc
 TA        Tg
 CG        At
G  A      |  a
A  C      |  t
A  C      |  c
A  A      |  a       aa
C  T      |  c      g  a
 CG       |  c      c  c
 CG       |  t       tg
 GC       |  c       gc
A  G       Cg        gc
 GC        Cg        cg
 CG        At        ta
 AT        Gc        cg
                        ctttgttgcaatgtaacccatttcatggaagcctccaggcaagaatgaagaggtcgccggggtttgtgtcgtgttgcgtgaagcatctcgatgcggtccattgagcgactgcgaagggagcgaacATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG2303 Choline dehydrogenase and related flavoproteins ... can be seen here

    ..................................................................................................................