Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCGTCTCGCCATCGAGAAGGGCCAGCCGGTCCCGCCCGAGGTGATCGAGGCCCTGAC
CCGTAATGTGAAGACGCCGCCGACCCGGCTGCGCGATCTGCGCGCCGGGATCATCTGG
CTGGCGATCGGCGTCGGCGTGGCGCTGGCGACTTACTTCGGCGACTTCATCCATGGCG
ACGGCGATTTCGACGGCTTTGGCATCGCCTGCATTCCCGCCGTGATCGGCGTGGCGTT
TATTGTTTTGAGCTTCTTCAATCCGAACAAGGAACAACGGGTCTAGCGCCCGAGGCCT
TGGGAGGGGCTTG

    CC1649 --- CC1650


Gene: CC1649     GI: 16125895     BI number: CC1649     GOG: COG1595     Description: RNA polymerase sigma-70 factor, ECF subfamily
Gene: CC1650     GI: 16125896     BI number: CC1650     GOG: -------     Description: hypothetical protei



  G
G  C
C  T
 AT
 GT
 CG
 TG
T  C       GA
 TA       T  T
 AT        GC
 GC        CG
 CG        CG
 GC        GC
 GC        CG
|  T      C  T
|  G      C  |
|  C      T  |
|  A      T  |
|  T      A  |
|  T      C  |
C  C      G  |
A  C      T  |
 GC        CG
 CG        CG
 GC        GC
 GC        CG
            TTTATTGTTTTGAGCTTCTTCAATCCGAACAAGGAACAACGGGTCTAGCGCCCGAGGCCTTGGGAGGGGCTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1595 DNA-directed RNA polymerase specialized sigma subunit, sigma24 homolog ... can be seen here

    ..................................................................................................................