                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-34.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-20.20 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G=-19.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAATGGCCGCCTGATCACGGTGTCCAGCGAGGGTGAGGCCGTCGCCCTGAACGCCAAG
ACCGGCGCCAAGGAAAAGACCCTGAAGATCGGTTCGCCGGTCCTGCTGAACCCGATCG
CCGTGGGTGACATGATCTATCTCGTCACCGACGACGCCGAGCTGATCGCCGTCCGCTA
Agcttccggtcccgcgcgggacctgaggcccaaacccttgaagcccgggtcggcgcaagccggcccgggccttcgctttttcggctcccttttgcgatag
gggcgaaaatcgactactggacgcctATG

    CC1654 Gene: CC1654     GI: 16125900     BI number: CC1654     GOG: COG1160     Description: GTP-binding protei            cc           a  c            at            at            cg        ca           |  a      g  a           c  a       cg            cg        gc            gc        gc cg        gc        cg g  c      a  |       tg cg        gc        gc cg        tg        gc cg        cg        gc ta        cg        cg gc        at        cg gc        gc        cg c  t      g  g      |  c cg       g  |       gc ta        cg        at tg        gc        at cg        cg        gc gc        gc        tg                         ctttttcggctcccttttgcgataggggcgaaaatcgactactggacgcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1160 Predicted GTPases ... can be seen here     ..................................................................................................................