                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:144 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-29.80 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAACACGACGAACGCGACGGCCTTCACCGGCTTCTCGCCGTTCGGCTTCAACGGCCGC
TTCTTCTACGGCCGGGTCAGCGTCAGCTGGTAGgccatccggggtcttccgaccgagcttagaggcgggcgcggag
agcaatctccgcgcccgttcttttagtcccaacgtcagaagcggacgccccgccgaccgccgcgccttgcgcttggagccagccaaaacatacacagaac
atccccgttcatcttggggcgccgggccaactggcccgcgcgtcgcaaagcgcgtcgcgttaacctGTG

    CC1665 Gene: CC1665     GI: 16125911     BI number: CC1665     GOG: COG0305     Description: replicative DNA helicas            ag        ca           t  a      g  a cg        tg        at c  a       cg        gc t  c       gc        at t  c      a  g       gc cg       g  |       gc ta        cg        cg g  g       cg        gc gc       |  c       cg gt       a  g       gc g  t       gc        gc c  a       cg        gc cg        cg        cg ta        ta        gt                         tcttttagtcccaacgtcagaagcggacgccccgccgaccgccgcgccttgcgcttggagccagccaaaacatacacagaacatccccgttcatcttggggcgccgggccaactggcccgcgcgtcgcaaagcgcgtcgcgttaacctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0305 Replicative DNA helicase ... can be seen here     ..................................................................................................................