                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:142 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-23.10 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-17.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGTTCGAGGAAGATCGCGCGGCCGAAGCCGAAGCCGCCCAAGACATGGCGGAAGGCG
GCGCCGGCTCGTTCGAAGGCGACCACTACGAAGCCTAAtcccgtccgggatcagagctttgttacgaaaggc
ggcgcggagcaatccgcgccgtttttttctgcgcccgttatgagaacgcttcgatgctgggcgccttgtgtctaaattatgaacgacccatgttctcgat
gcggggcgactagaccccgccagcgccgacggccccgccgccacgcgcttgatcacgagaggggtaatcgATG

    CC1666 Gene: CC1666     GI: 16125912     BI number: CC1666     GOG: COG1629     Description: TonB-dependent recepto tc g  c cg cg cg         a        ca ta       a  g      g  a At       a  g       at A  c       gc        gc Ta        cg        gc Cg       a  g       cg |  a      t  c       gc Cg        tg        cg Gc        gc        gc At        tg        gc At        tg        cg Gt        ta        gt Cg        cg        gt At        gc        at                         ttttctgcgcccgttatgagaacgcttcgatgctgggcgccttgtgtctaaattatgaacgacccatgttctcgatgcggggcgactagaccccgccagcgccgacggccccgccgccacgcgcttgatcacgagaggggtaatcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1629 Outer membrane receptor proteins, mostly Fe transport ... can be seen here     ..................................................................................................................