                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-22.00 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGCAAGGGCGACGCTGGGCGGCGCGGATCAGTAGcgcctttcagcttcggttcatccacggcgccgcttgatg
gtcccgtaagccgaggagagcgccGTGGCCATCCGCCTGATCCTGATCTGCACCCTGCTGTCGCTGGC
CGCGCTGTCGGTGTTGGTGGACGGTCATCGCGCCGCTCCGATCACGGCGCGGGCGCCT
GTCACGACGGCGGGATAAacccgaagcgtcagccgagcgggcggcgacggttgtggcctattgacgccgcgccctccgccctccagc
ttcgcgcggttttTTG

    CC1683 Gene: CC1683     GI: 16125929     BI number: CC1683     GOG: COG3920     Description: sensor histidine kinase, putativ            tt           a  g           t  a           c  c            cg            gc            gc        tc            tg       c  c            gc       c  a cg       t  |       cg g  a       tg        gc gc        gc       c  t cg        gc       c  t g  g      c  c      t  c gt       a  t      c  | gt       g  |      c  | cg       c  |       cg gt        gc        gc a  |       gc        cg g  |       cg        gc cg        gc        cg cg        gc        cg gc        gc        gt                         tttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG3920 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................