                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=18 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtcgagcggggacaggttcgaggggggtactcggacggtccggggatctggttgctggccagacccgcccgccgtcggcgtggtcgggggaaagggtttc
gtccctcttcgatcgccgggcgctgccggaaacggaagcgcccgggtcccggtaaggcccgaacagggccaccttcccgggaggctggcggataacggct
gcgcggagcgtcgggcttcgtcgaaacggtatttttcaaactcttccggacgaacgtccggcgctccgcgtccctttccagaccttcagcggccagccgc
GTG

    CC1748 --- CC1747 Gene: CC1748     GI: 16125992     BI number: CC1748     GOG: COG2211     Description: sodium:galactoside symporter family protein Gene: CC1747     GI: 16125991     BI number: CC1747     GOG: COG1694     Description: mazg protei                       c                     t  g                     g  g                      cg                      gc                      at                      gt                      gc                      cg             g       |  t ga       c  g       gc g  t      g  a       cg c  a       cg       |  a g  a       gc       |  a gc       t  |      |  a tg        cg        gc cg        gt        tg gc        gc        cg gt        cg        gt                         atttttcaaactcttccggacgaacgtccggcgctccgcgtccctttccagaccttcagcggccagccgcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2211 Na+/melibiose symporter and related transporters ... can be seen here [R] COG1694 Predicted pyrophosphatase ... can be seen here     ..................................................................................................................