                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCTTGGCCAGATCCTGACCAAACAAACGCACCTGACCCGACGTGGGTTCTTCCAGG
CCCGCGCCGACCGCAATCAGCGACGACTTGCCCGAGCCCGAGGGACCGATGATCGCCA
CCCGCTCGCCGGGGTTCACCACGAGGTCGACGCCGCGCAGGATGTTTACGGGACCGGC
GGAGGAGGGCAGGGTCAGGGCGACGGCGTCGAGGACCAGAGGCGCGGCGGGCGTAACG
TCGTCGGACATgggttttcctgcgaggccggtccttgtttggccggcagctagactacataggaaagcATG

    CC1760 Gene: CC1760     GI: 16126004     BI number: CC1760     GOG: COG2755     Description: acyl-CoA thioesterase   G C  T G  A G  A GC CG GT GC CG |  T        t GC       c  g CG       c  c |  G       tg G  A       ta G  C       tg A  A       tg G  T       gc A  g       gc Cg       g  g Cg       T  | At       A  | Gt        Cg Gt        At At        Gc Gc        Gc             ttgtttggccggcagctagactacataggaaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2755 Lysophospholipase L1 and related esterases ... can be seen here     ..................................................................................................................