                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -7.92 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aataacagtcaggccgaatttttagacttcggtttggcgaggttcgcgccatcgcgcgaccagctagcgtcctcacgacagaaactttgacgctcaaagg
ccatcaactctgaggtttttcggacaacgactaacggggccatcaaatatgacccgtgacaggtgatgtgcaacaccgccgaagatgtgcattcttctga
taatatatcttagacgaactatggatctgcaacggcggattctattttgaagtgcgatttgtgagggtttttatggacttaggtccacggagattttcac
ATG

    CC1761 Gene: CC1761     GI: 16126005     BI number: CC1761     GOG: COG2826     Description: IS30 family, transposas             a           t  t           a  a           a  t           t  c            at   c        gt g  c       ta c  g       cg c  a       ta a  a      t  c c  g       cg a  a       ta at        ta cg       |  c g  t      |  t t  g      |  a gc       |  t       ac ta       |  g      a  g at       |  g       cg gt       |  a       gc |  c      |  t       tg t  t      |  c       cg gt        at        ta gc        cg        at at        gc        gt cg        ta        gc                         tattttgaagtgcgatttgtgagggtttttatggacttaggtccacggagattttcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2826 Transposase and inactivated derivatives, IS30 family ... can be seen here     ..................................................................................................................