                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G=-20.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-17.80 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-17.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAGCCCCGCGCCCTTCTGCTCTTGCCCAGCCTTCGGCGGCGAAGACCTCGACATTCT
TTATGTGACCTCGATTTCCGACAGCGGCGGCCGGCTGAAAACCGACGTCGACGCTTCC
GGTCGCCTGATGGCGTTCCACGGTCTTGGCGTGCGCGGCATCGCCGAGACCCGTTGTT
TCCTCTGAcccgtggtgaaccatgaatcttgacctgaccccggagcagtccgccttccgcgacgaggtgcgcgccttcttcgccgaaaacgtcc
ccgagtcgttcaaaagccgcgtgcgcgccggcATG

    CC1806 --- CC1807 Gene: CC1806     GI: 16126050     BI number: CC1806     GOG: COG1960     Description: acyl-CoA dehydrogenase family protein Gene: CC1807     GI: 16126051     BI number: CC1807     GOG: COG1960     Description: acyl-CoA dehydrogenase family protei            GA           T  T            CG            CG            GC CG        CG A  T      |  T GC       |  T CG       |  C C  A      T  C A  C      G  A        C A  G       GC       G  G A  C       CG        CG A  T       CG        GC G  T      |  T       TA T  |      |  C      |  T C  |      |  T       GC GC       T  T       CG GC        TG        GC CG        CG        GC CG        GC        TG GT        CG        TA GC        AT        CG CG       |  G       TA GC        GC        GC GC        CG        GC                         CGTTGTTTCCTCTGAcccgtggtgaaccatgaatcttgacctgaccccggagcagtccgccttccgcgacgaggtgcgcgccttcttcgccgaaaacgtccccgagtcgttcaaaagccgcgtgcgcgccggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here     ..................................................................................................................