                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-25.10 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGGGCGATCACCGACGTCTTCCTGATGGACGAAGCGCTGGGCCAGGTCGCCAACGCC
GTCTTCACCGAGCCGCGCATCATCGGCGTTTCCCTCCAAAAGACCTTCTAGttcttccgcaa
aggtcctcggacatctggcggcggtcgaaaggccgccgcctttttttggtgcgcgcatcacgtcggtgatgtttccgcttcgctggacgcggcatcgagg
cgcgcggggagggcgggctattgatggatcctaatatcgatcgcgcctagagccggtcgcaaatgcgggaggagggaacgATG

    CC1808 Gene: CC1808     GI: 16126052     BI number: CC1808     GOG: COG1028     Description: oxidoreductase, short-chain dehydrogenase/reductase famil            tc           c  g            cg tt        ta c  c       gc t  c      |  a       aa tg       g  t      g  a Gc       a  c       cg A  a      a  t       tg T  |      a  g       gc C  |       cg        gc Ta        gc        cg Ta        cg        gc Cg        cg        gc Cg       t  c       cg At        tg        gc Gc        cg        gc                         tttttttggtgcgcgcatcacgtcggtgatgtttccgcttcgctggacgcggcatcgaggcgcgcggggagggcgggctattgatggatcctaatatcgatcgcgcctagagccggtcgcaaatgcgggaggagggaacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................