                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:166 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-25.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGTGGTGCTGGATTGGGGATAGCCGAGTTTCTCGAAAATGTAGGTCAGCCGCAGAG
GCGCGCGCTGCTCCTGGAACAGCTCCAGGATCTCCAGGGTGCGCGCAGCGGATTTGAT
CGGGTCTCGGCGCATttttaggttccaactggtggcggttcagtctgccagcacagcggcttagagcgtcgcgCTACCGCTG
CGTCCAGCGTTCCAGCACATATGTGATGTTGTCCAGCCCATGGGCGAGGTCGGCCCGG
CCAGAAAAACGACGCGGAAAGCCGTAAACCCGCGGCCTCGATGAGTG

    CC1809 Gene: CC1809     GI: 16126053     BI number: CC1809     GOG: COG1629     Description: TonB-dependent recepto   A C  G A  C AT GC GC TA CG CG TA                  AT |  T                G  C |  C                 TG |  T                 TG C  C                 TG GC         C        AT TA       G  A       GC CG        CG        GT G  G       GC       C  C CG        CG       G  G GT       G  G      A  | CG        TA        CG GC        GT        GC CG        GT        CG GC        GT        GC                         ATttttaggttccaactggtggcggttcagtctgccagcacagcggcttagagcgtcgcgCTACCGCTGCGTCCAGCGTTCCAGCACATATGTGATGTTGTCCAGCCCATGGGCGAGGTCGGCCCGGCCAGAAAAACGACGCGGAAAGCCGTAAACCCGCGGCCTCGATGAGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1629 Outer membrane receptor proteins, mostly Fe transport ... can be seen here     ..................................................................................................................