Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:194 nt.     Distance to run of Ts=0 nt.   Size=14 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=75 nt.     Delta G=-27.66 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAATGGATTGGCCGGTCAGCACGTCGCGCGTCGACCGGCGGGTCGTTCCCGTTCCCAT
gtttcctccaaccggttgcgtgtcgcggtccgctttcgagcggttattttccggtccggcgcacgcccaagcgctcgccatgcggaacaacagcacgcga
gggcgaaaggttaaagtcgcgcagccgtcgaacctctcagtatcgcgtatgtgaaaagacggggggcaagagagccgcctccgggtgaggcgagatccgt
ccctatggtcgggcgcaaagaccaccggatacaggaatagccATG

    CC1812


Gene: CC1812     GI: 16126056     BI number: CC1812     GOG: COG0318     Description: medium-chain-fatty-acid--CoA ligas


  G
C  T
T  T
 GC
 GC
 GC
 CG
|  T
|  T
|  C
|  C
|  C
|  A
|  T
|  g
|  t
|  t
|  t
|  c
|  c
|  t
|  c
|  c
|  a
|  a
 Gc
 Gc
 Cg
 Cg
 At
 Gt
 Cg
T  |
 Gc
 Cg
 Gt
 Cg
 Gt
C  c
 Tg
 Gc
 Cg
|  g       tc
|  t      t  g
|  c       ta
A  c       cg
 Cg        gc
 Gc        cg
 At        cg
            ttattttccggtccggcgcacgcccaagcgctcgccatgcggaacaacagcacgcgagggcgaaaggttaaagtcgcgcagccgtcgaacctctcagtatcgcgtatgtgaaaagacggggggcaagagagccgcctccgggtgaggcgagatccgtccctatggtcgggcgcaaagaccaccggatacaggaatagccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[IQ] COG0318 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II ... can be seen here

    ..................................................................................................................