                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:211 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-23.80 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-17.10 kcal/mol
Anti-antiterminator:   Size=19 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcaggagatcggccttgccggtctcgctctgtggcgtcttccccgacgatgactgacaggccgcgcggcgatccgcgcggcctttcttttgcccgtcgc
gcagccttacttccgcccaaagcgcgacggcacaaagtggtcgttggcgtctgtaatcgtcgcgcttccgggcttggagggaggagcgtgttgcccggtt
tggatcaaagatctgagccaggccggctctaccgcgttgccaagctgtcgggcgaggggctatctcaggcccttctcgaattcccggagtttccaagctg
ATG

    CC1931 --- CC1930 --- CC1929 Gene: CC1931     GI: 16126174     BI number: CC1931     GOG: COG0442     Description: prolyl-tRNA synthetase Gene: CC1930     GI: 16126173     BI number: CC1930     GOG: COG4591     Description: conserved hypothetical protein Gene: CC1929     GI: 16126172     BI number: CC1929     GOG: COG1136     Description: ABC transporter, ATP-binding protei            cg           c  a           c  c            cg            ta           t  t            cg            ta            gc           |  t           |  g           |  a           |  c           |  a           |  g       ga            cg       c  t            gc        gc   c        gc        gc t  t       tg        cg cg        gc        gc gt        tg        cg cg       c  c       gc tg        tg        cg Gc        cg        cg Tg        gc        gc At        cg        gc gc        ta        at                         ttcttttgcccgtcgcgcagccttacttccgcccaaagcgcgacggcacaaagtggtcgttggcgtctgtaatcgtcgcgcttccgggcttggagggaggagcgtgttgcccggtttggatcaaagatctgagccaggccggctctaccgcgttgccaagctgtcgggcgaggggctatctcaggcccttctcgaattcccggagtttccaagctgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0442 Prolyl-tRNA synthetase ... can be seen here [M] COG4591 ABC-type transport system, involved in lipoprotein release, permease component ... can be seen here [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here     ..................................................................................................................