                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-24.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCCGATCTATGAAGACAAGGTCGTCGACCTGATCTTCGGCAAGGCCAAGATCGAGG
AAAAGGAAGTCTCCAAGGACGAACTCTTGGAAGAAGACGACCTGCCGGAAGGCTATGG
CGGCTAAggctcgctgaagcggaaattgaacgaggcgcggctcgcgagggccgcgcctttttcgtttcaggccgcgtcgcgcgctccttgcaacc
tgttaaggggaacgcgatatgcgtgagcgacgccacgcggaggctgattcgttttcgcgtcgccagcacacacaaaaagggtgatccccATG

    CC1963 Gene: CC1963     GI: 16126206     BI number: CC1963     GOG: COG0740     Description: ATP-dependent Clp protease, proteolytic subuni             t           a  t           a  g           a  a           g  a            gc            cg           g  a           a  |           a  |           g  |            tg            cg            gc            cg           |  c            tg        cg            cg       g  a            gc        cg AA        gt        tg T  g      A  |       cg Cg       A  |       gc Gc       T  |       gc |  t      C  |       cg Gc       G  |       gc Cg        Gc        cg Gc        Cg        gc Gt        Gc        gc                         tttttcgtttcaggccgcgtcgcgcgctccttgcaacctgttaaggggaacgcgatatgcgtgagcgacgccacgcggaggctgattcgttttcgcgtcgccagcacacacaaaaagggtgatccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OU] COG0740 Protease subunit of ATP-dependent Clp proteases ... can be seen here     ..................................................................................................................