                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:146 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-19.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -7.05 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-22.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccccgcccgcaacccgtaatgccgggcgcacGCGGATGTGGCGAAACTGGTAGACGCACTGGATTTAGGTT
CCAGCGCCGCGAGGCGTGGAGGTTCGAGTCCTCTCATCCGCACCAtacctctcgtagcaccccttag
ggggtgtacgagttttatcgccgccgctcttggatgctcgcgcacgtcgtgacataagggcgctctttcgccgccccggcacctcctgggcggcgtcgat
cttttggaccccagggcggagctcgggcgcccggcgccccgacccgagaattaagaatgtcgATG

    CC1964 Gene: CC1964     GI: 16126207     BI number: CC1964     GOG: COG0544     Description: trigger facto            CG CG       C  C G  A      T  A CG       A  C CG       C  C GC       T  A CG       C  t G  |      T  a AT       C  c       ta CG       C  c      t  g CG       T  t       cg TA        Gc        cg TG        At        cg G  G       Gc        cg GT        Cg        at AT       |  t       cg |  C       Ta       g  | TG        Tg        at TA        Gc        ta TG       G  a       gc AT       A  c       cg GC        Gc        ta GC        Gc        cg                         ttttatcgccgccgctcttggatgctcgcgcacgtcgtgacataagggcgctctttcgccgccccggcacctcctgggcggcgtcgatcttttggaccccagggcggagctcgggcgcccggcgccccgacccgagaattaagaatgtcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0544 FKBP-type peptidyl-prolyl cis-trans isomerase (trigger factor) ... can be seen here     ..................................................................................................................