                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:5 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-28.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACGAAATCTCGATCTGGTGCGTTTGGCTGATTGAGCGCCGTCGCAAGGAAGAAGACG
AGAAGGCCGGTACGGACCTGGTCGTTTCGTAAggcaagggcggtctttgccttgagcctgggtgccggtgaggatt
tgtgcgaaccgaggccagcagtcgtcctcaccctgagcttgtcgaagggcgagaacggccaccaagacgcgtccacactcgatatgaattcagccaaaag
aaaagggctccgcgatcctgtcgcggagcccttcttttcgcccggtgaggagcgaggtgttttcagGTG

    CC2000 --- CC1999 --- CC1998 --- CC1997 Gene: CC2000     GI: 16126243     BI number: CC2000     GOG: -------     Description: hypothetical protein Gene: CC1999     GI: 16126242     BI number: CC1999     GOG: COG0172     Description: seryl-tRNA synthetase Gene: CC1998     GI: 16126241     BI number: CC1998     GOG: COG0496     Description: stationary-phase survival protein SurE Gene: CC1997     GI: 16126240     BI number: CC1997     GOG: COG2518     Description: protein-L-isoaspartate(D-aspartate) O-methyltransferas   c c  t tg at gc cg gc cg cg         c ta       c  g cg        cg gc        gt gc        cg gc        ta at        tg a  |       tg a  |       ta at        cg gc       |  c at        tg at        ta at        cg at        cg             tgttttcagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0172 Seryl-tRNA synthetase ... can be seen here [R] COG0496 Predicted acid phosphatase ... can be seen here [O] COG2518 Protein-L-isoaspartate carboxylmethyltransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_crescentus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-25.20 kcal/mol                                                                         Nomenclature/Definitions TACGAAATCTCGATCTGGTGCGTTTGGCTGATTGAGCGCCGTCGCAAGGAAGAAGACG AGAAGGCCGGTACGGACCTGGTCGTTTCGTAAggcaagggcggtctttgccttgagcctgggtgccggtgaggatt tgtgcgaaccgaggccagcagtcgtcctcaccctgagcttgtcgaagggcgagaacggccaccaagacgcgtccacactcgatatgaattcagccaaaag aaaagggctccgcgatcctgtcgcggagcccttcttttcgcccggtgaggagcgaggtgttttcagGTG     CC2000 --- CC1999 --- CC1998 --- CC1997 Gene: CC2000     GI: 16126243     BI number: CC2000     GOG: -------     Description: hypothetical protein Gene: CC1999     GI: 16126242     BI number: CC1999     GOG: COG0172     Description: seryl-tRNA synthetase Gene: CC1998     GI: 16126241     BI number: CC1998     GOG: COG0496     Description: stationary-phase survival protein SurE Gene: CC1997     GI: 16126240     BI number: CC1997     GOG: COG2518     Description: protein-L-isoaspartate(D-aspartate) O-methyltransferas            c          c  t           tg           at           gc           cg           gc           cg           cg           ta           cg           gc           gc           gc           at             tcttttcgcccggtgaggagcgaggtgttttcagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0172 Seryl-tRNA synthetase ... can be seen here [R] COG0496 Predicted acid phosphatase ... can be seen here [O] COG2518 Protein-L-isoaspartate carboxylmethyltransferase ... can be seen here     ..................................................................................................................