Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-22.40 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-20.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGAGGAGCGCACATCGAAGAGGCTGGAGCGATCGCTCATatcgtcagatctcggacttttccggcggg
ccgggctctctccgcgcgcgtcttccgtcggggggccttttcgcttgccgatgggttcgctagggaaccggcaggcgtcttttggcgcttcgcgacggat
gataccggcgtggagagccgccggtgtctctacagtaaaacttcgatcacaaattcgctaccggaaatcacgcggatttcgcagttgcgagaagatttcg
tgacgccgcaggccaaagtgatcgcgcgtcGTG

    CC2017


Gene: CC2017     GI: 16126260     BI number: CC2017     GOG: -------     Description: hypothetical protei


  c
t  t
c  c
t  c
 cg
 gc
g  g
 gc
 cg        tt
|  c      t  t
 cg       c  c       ta
 gt        cg       c  g
|  c       gc       g  g
|  t       gt        cg
|  t       gt        ta
 gc       g  g       ta
 gc        gc        gc
 cg        gc        gc
 gt        cg       g  |
 gc        ta       t  |
 cg        gt       a  |
 cg        cg       g  |
t  g       cg        cg
t  g       tg        cg
 tg       t  t       gc
 tg       c  t       ta
c  |      t  |       tg
a  |       gc        cg
 gc        cg        gc
 gc        gc        cg
                        tcttttggcgcttcgcgacggatgataccggcgtggagagccgccggtgtctctacagtaaaacttcgatcacaaattcgctaccggaaatcacgcggatttcgcagttgcgagaagatttcgtgacgccgcaggccaaagtgatcgcgcgtcGTG


    ..................................................................................................................