                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-21.44 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGTCCTGGCCGTGCCTCTGACCATGCTGGGCGCGCACAAGGTGGCCGGCCTGAAGCT
GAAGGCCAACGGCCTGTTCATGACGCCGGAAGAGCGCCGCCCGCCGGCCATCGTCCGC
GCCGCCGTGGGCGCGGCCTGCGAGCCGCCGATCCGCTGGTTCGCCCGGAACGGTCGCC
CGATCGGCCCGACGACCAAGATCCGCGACGCGGCCTAAtccacgggtaaagcgtcgatccgactggtcctcc
aaggcccggagcggtagaagcgcggcttcgtttgttttttcggagccgggtgccGTG

    CC2019 Gene: CC2019     GI: 16126262     BI number: CC2019     GOG: -------     Description: conserved hypothetical protei   c t  c A  a A  c Tg Cg Cg Gt |  a |  a        c G  a      c  a Cg       t  a Gc        cg Cg        cg At       t  c Gc        gc Cg        gc G  a       tg        aa C  t       cg       g  g C  c      |  a      a  c T  c      a  g       tg A  g       gc        gc G  a       cg       g  g A  c       cg        cg At       t  t       gc Cg       a  a       at Cg       g  |       gt At        cg        gc Gc        ta        cg                         tttgttttttcggagccgggtgccGTG     ..................................................................................................................