                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=31 nt.     Delta G=-13.00 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-21.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGAGACGCCGCCGCAGCGTCGGGCAAGGCCATCACGCCGGTGCGGGTGATCGAAAG
CAAGCAGAACGACGGCATGGTCATCTACGAGCTTTTCGCCGCGGGCAAACCGAAGGAT
CCGTCGATGGAGGTCAGCTTCAAGGACGGTCAAGCCAAGGTTCTCAGCGAGGTGTGGC
CGCACTAGccgctgaaaccgtcacccgaccttacgggttcgcggggccgaggctggcgcgtcgcgccaagcacagctaaatgcgggttgcccgg
aaaacgggcatgggccaccttgcggcccttctTTG

    CC2020 Gene: CC2020     GI: 16126263     BI number: CC2020     GOG: COG0534     Description: MATE efflux family protei   t g  c cg gc cg gc gc |  a ta         a cg       a  a gc       g  a g  a       gc a  c       cg g  a       cg c  |       cg cg        gc gc        ta gt       |  t |  a      |  g        t |  a      |  g      c  t g  a      |  g      c  g gt       |  c      a  c cg       |  c       cg gc        ta        cg cg        gc        gc tg        gc        gc tg        gt        gc                         ttctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG0534 Na+-driven multidrug efflux pump ... can be seen here     ..................................................................................................................