                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:213 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-31.40 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-10.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAAGGGCTACGATGACGCTGTGGCCCGGGCGCGGATCAGTCAGGCCTTCGGGCGGCT
GATCCGGCGCGCCGACGACCGGGGTGTTTTCGTGATGCTGGATGCGGCCGCGCCCACG
CGGCTGTTCTCGAGCCTTCCCGAGGGCGTCACGTTGGAGCGGGTCAGCTTGGTCGAGG
CCATCGAAGCGACCGGCGCCTTCCTGGCCAAGAAAGAGGCCTGAgcccgcgccgcccaaacgccgaa
caatgatcgcatgatgcgtccggttcgcctccggagccgtaacgaccccgtcacgaggaGTG

    CC2037 Gene: CC2037     GI: 16126280     BI number: CC2037     GOG: -------     Description: hypothetical protei            TC           T  G            CG            CG            GC           G  | GA       A  | G  T       CG C  C       TG G  A       GC CG        AT GT        CG GC        TA G  A       AT C  |       GC CG        GC CG       |  G GC        CG        CC GC        GC       G  G GT        CG       C  A T  |       GC        GC G  |      G  |       CG a  |      G  |      |  A g  |      C  |       GC g  |      C  |       GC aT        CG        CG gC        GC        CG cG        GC        TG                         GTGTTTTCGTGATGCTGGATGCGGCCGCGCCCACGCGGCTGTTCTCGAGCCTTCCCGAGGGCGTCACGTTGGAGCGGGTCAGCTTGGTCGAGGCCATCGAAGCGACCGGCGCCTTCCTGGCCAAGAAAGAGGCCTGAgcccgcgccgcccaaacgccgaacaatgatcgcatgatgcgtccggttcgcctccggagccgtaacgaccccgtcacgaggaGTG     ..................................................................................................................