                                                                        Gene putatively regulated by attenuation in C_crescentus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:162 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-10.50 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcgccggagcttcgccctcagcgccctcttcgccttcgggagcgggagcttccttttcgggtttcttggccacgcgcgcggttccttggaatctatacc
cgtactcatgcgcgaagcatggttaacgatgtgttttgccgggcaattggtcgcaggctgaatctgcccggcagagtccgaccagcacgcccgcgttaac
cttcctatttgttgattttaatggcattttagcgctggcacgaaggttgcttctggggttgcgacgcatttgtcgcgtcagccgcccgagttaactcgcc
ATG

    CC2063 --- CC2064 --- CC2065 --- CC2066 --- CC2067 Gene: CC2063     GI: 16126302     BI number: CC2063     GOG: COG4786     Description: flagellar basal-body rod protein FlgF Gene: CC2064     GI: 16126303     BI number: CC2064     GOG: COG4786     Description: flagellar basal-body rod protein FlgG Gene: CC2065     GI: 16126304     BI number: CC2065     GOG: COG1261     Description: distal basal-body ring component protein FlaD Gene: CC2066     GI: 16126305     BI number: CC2066     GOG: COG2063     Description: flagellar L-ring protein Gene: CC2067     GI: 16126306     BI number: CC2067     GOG: -------     Description: hypothetical protei             t           c  a           t  t gc       a  a c  g      a  c        g gc        gc       c  a cg        gc       g  a a  g       tg        cg c  t      t  t       gc c  t      c  a       ta gc       c  c       at gc       t  t       cg t  t      t  c      t  | t  t      g  a       cg cg        gt        at tg        cg       |  t ta        gc       |  a ta        cg        ta gt        gc        gc gc        cg        cg                         atgtgttttgccgggcaattggtcgcaggctgaatctgcccggcagagtccgaccagcacgcccgcgttaaccttcctatttgttgattttaatggcattttagcgctggcacgaaggttgcttctggggttgcgacgcatttgtcgcgtcagccgcccgagttaactcgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG4786 Flagellar basal body rod protein ... can be seen here [N] COG4786 Flagellar basal body rod protein ... can be seen here [NO] COG1261 Flagellar basal body P-ring biosynthesis protein ... can be seen here [N] COG2063 Flagellar basal body L-ring protein ... can be seen here     ..................................................................................................................