                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:151 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-21.90 kcal/mol
Antiterminator:    Distance from promoter:45 nt. Size=16 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-17.91 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtag-tacgat. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtagaaaaattccattttttttacgatccgtggccaacaagtttttttcttaaggactggttaacagtcctttccttgggtctagggaaagatcactt
ctttccctaggctgtctttttctctaaaaaatttaaaaaagcttttagaaaggcggcgtctagaattgcagctaaggatttgttttgttttttttagaat
agaggcaataataggctcttttctcgggaacttcgctcaagctagagtagcattctgataaaagaggaggatcATG

    TC0056 --- TC0057 --- TC0058 --- TC0059 Gene: TC0056     GI: 15834681     BI number: TC0056     GOG: COG0719     Description: conserved hypothetical protein Gene: TC0057     GI: 15834682     BI number: TC0057     GOG: COG0396     Description: ABC transporter, ATP-binding protein Gene: TC0058     GI: 15834683     BI number: TC0058     GOG: COG0719     Description: conserved hypothetical protein Gene: TC0059     GI: 15834684     BI number: TC0059     GOG: COG0520     Description: aminotransferase, class   t t  a g  a gc ta cg at gc gc at at t  t t  | c  | t  | t  | t  | t  | t  | t  | t  | g  |                  a a  |                c  c a  |                t  t c  |                 at a  |                 gc a  |                 at c  |                 at c  |                 at gc                  gc gc        gt        gc t  t      g  c       gc gt        gt        at cg        ta        ta cg        tg        cg tg        cg        tg at        cg        gc gc        ta        gt                         gtctttttctctaaaaaatttaaaaaagcttttagaaaggcggcgtctagaattgcagctaaggatttgttttgttttttttagaatagaggcaataataggctcttttctcgggaacttcgctcaagctagagtagcattctgataaaagaggaggatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [E] COG0520 Selenocysteine lyase ... can be seen here     ..................................................................................................................