                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCAGCAACATATAGTAGAGGTTTCTTTACTGTTGGCAGCATAGtaattttctctcttataagtgag
cccggcataagggtttagctctcgtattgtacgagtgctttttgttttctttttctcgaggaaagtctagaatgtgcctgaatgcacggatttcttttct
ctcgagtaggctttcctaaagagattttgtgtataaaaagataattatcaaaaagaaataaaagagctccgttcttgttgtacaggcgcacctaagtaag
aattcgagtttttcaaaagcatgtgttgaacatATG

    secA Gene: secA     GI: 15834699     BI number: TC0074     GOG: COG0653     Description: preprotein translocase SecA subuni   g c  a t  g cg ta ta ta tg |  t |  c |  t ta         c cg       t  t ta       t  t ta       t  t |  t       at |  g       gc t  t       gt        tt tg       c  c      c  t gc       a  t       gc t  c      c  |       gc t  t       gc        at tg        tg        ta ta       a  a      g  a ta       a  g      a  a |  t       gt       g  | cg        ta        cg gc        cg        ta ta        cg        cg gc        gc        ta                         ttttgtgtataaaaagataattatcaaaaagaaataaaagagctccgttcttgttgtacaggcgcacctaagtaagaattcgagtttttcaaaagcatgtgttgaacatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0653 Preprotein translocase subunit SecA (ATPase, RNA helicase) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:179 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -9.50 kcal/mol Antiterminator: Size=26 nt.     Delta G= -8.30 kcal/mol Anti-antiterminator:   Size=44 nt.     Delta G= -5.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATCAGCAACATATAGTAGAGGTTTCTTTACTGTTGGCAGCATAGtaattttctctcttataagtgag cccggcataagggtttagctctcgtattgtacgagtgctttttgttttctttttctcgaggaaagtctagaatgtgcctgaatgcacggatttcttttct ctcgagtaggctttcctaaagagattttgtgtataaaaagataattatcaaaaagaaataaaagagctccgttcttgttgtacaggcgcacctaagtaag aattcgagtttttcaaaagcatgtgttgaacatATG     secA Gene: secA     GI: 15834699     BI number: TC0074     GOG: COG0653     Description: preprotein translocase SecA subuni   c t  t t  c t  t t  c at at ta Gt |  a        a A  a      c  t Tg       g  a        t At       g  a      t  g Cg        cg        at G  a       cg        ta A  g       cg        gc C  c       gt        cg Gc        at        ta Gc        gt        cg Tg        ta       t  t Tg       |  g       cg Gc        gc        gc Ta        at        at                         ttttgttttctttttctcgaggaaagtctagaatgtgcctgaatgcacggatttcttttctctcgagtaggctttcctaaagagattttgtgtataaaaagataattatcaaaaagaaataaaagagctccgttcttgttgtacaggcgcacctaagtaagaattcgagtttttcaaaagcatgtgttgaacatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0653 Preprotein translocase subunit SecA (ATPase, RNA helicase) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:187 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -9.50 kcal/mol Antiterminator: Size=26 nt.     Delta G= -8.30 kcal/mol Anti-antiterminator:   Size=23 nt.     Delta G= -7.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATCAGCAACATATAGTAGAGGTTTCTTTACTGTTGGCAGCATAGtaattttctctcttataagtgag cccggcataagggtttagctctcgtattgtacgagtgctttttgttttctttttctcgaggaaagtctagaatgtgcctgaatgcacggatttcttttct ctcgagtaggctttcctaaagagattttgtgtataaaaagataattatcaaaaagaaataaaagagctccgttcttgttgtacaggcgcacctaagtaag aattcgagtttttcaaaagcatgtgttgaacatATG     secA Gene: secA     GI: 15834699     BI number: TC0074     GOG: COG0653     Description: preprotein translocase SecA subuni             t           a  a   g       t  a        t t  a      t  g      t  g t  a       ct        at gc        tg        ta ta        ca        gc gt        tg        cg tA        cc        ta aT        tc        cg cG        tc       t  t gt       |  g       cg at        tg        gc at        tc        at                         ttttgttttctttttctcgaggaaagtctagaatgtgcctgaatgcacggatttcttttctctcgagtaggctttcctaaagagattttgtgtataaaaagataattatcaaaaagaaataaaagagctccgttcttgttgtacaggcgcacctaagtaagaattcgagtttttcaaaagcatgtgttgaacatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0653 Preprotein translocase subunit SecA (ATPase, RNA helicase) ... can be seen here     ..................................................................................................................