                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-10.30 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -3.64 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTGAAGGAGTTTACACAGCTCTATCCGCTCATCAAATTGCCACACATCACAAGATAG
ACATGCCCATCACTACTGGTGTCTATCGTGTTCTTTATGAAAATCTAGATATTCAAAA
GGGAATTGCCCAGCTTCTTCAACGGAATACAAAAGAAGAATATTTATAAggcttttccttcaaa
gaaaaaatctctgaaaagctttgtcccgttggtggacgaagtttttcctttgtacaattttttggcatttgctaaagatacggattcagtcccagaccat
acagaaaggcccttgactaaATG

    TC0086 Gene: TC0086     GI: 15834711     BI number: TC0086     GOG: NOG05014     Description: major outer membrane protein, putativ AT A  A        a G  C      a  a G  A      a  t C  A      a  c A  A       at A  A       gc CG        at TA       a  | TA       a  | CG       c  | TA       t  | |  A      t  | |  T      c  | |  A       cg         t |  T       ta       t  g |  T       ta       g  g |  T       ta       c  t |  A       ta        cg |  T       cg        cg |  A       gc        ta |  A       gt        gc Tg        At        tg Cg        At        ta Gc        Tg        ta At        At        cg                         tttttcctttgtacaattttttggcatttgctaaagatacggattcagtcccagaccatacagaaaggcccttgactaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.50 kcal/mol Antiterminator: Size=43 nt.     Delta G=-10.30 kcal/mol Anti-antiterminator:   Size=42 nt.     Delta G= -3.64 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTTGAAGGAGTTTACACAGCTCTATCCGCTCATCAAATTGCCACACATCACAAGATAG ACATGCCCATCACTACTGGTGTCTATCGTGTTCTTTATGAAAATCTAGATATTCAAAA GGGAATTGCCCAGCTTCTTCAACGGAATACAAAAGAAGAATATTTATAAggcttttccttcaaa gaaaaaatctctgaaaagctttgtcccgttggtggacgaagtttttcctttgtacaattttttggcatttgctaaagatacggattcagtcccagaccat acagaaaggcccttgactaaATG     TC0086 Gene: TC0086     GI: 15834711     BI number: TC0086     GOG: NOG05014     Description: major outer membrane protein, putativ AT A  A        a G  C      a  a G  A      a  a C  A      a  t A  A       gc A  A       at CG        ac TA       a  | TA       c  | CG       t  | TA       t  | |  A      c  | |  T      c  | |  A       tt         t |  T       tg       t  g |  T       ta       g  g |  T       ta       c  t |  A       ca        cg |  T       ga        cg |  A       gg        ta |  A       Ac        gc Tg        At        tg Cg        Tt        ta Gc        At        ta At        Tg        cg                         tttttcctttgtacaattttttggcatttgctaaagatacggattcagtcccagaccatacagaaaggcccttgactaaATG     ..................................................................................................................