                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:182 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATAAAAGTAGATGAACAGTCTCTTTTATTTTAAtccctttaaccccctaaaaaacaatttttagacaatatattgt
ttttaatgacgcccttttgttacagaagacaaaagggctcttttaacataaaagcccttttgagcctcttggtcattccggctgcaaaatcttcttcttg
gcaataaggagaagatttcttcttttccattttctctgcagaatacttaacaggctctacctttgctctattccccgaattatgcgtagagcttttgtaa
gaatttgcttcatggagaacactgGTG

    TC0092 --- TC0091 --- TC0090 --- TC0089 --- TC0088 --- TC0087 Gene: TC0092     GI: 15834717     BI number: TC0092     GOG: COG1536     Description: conserved hypothetical protein Gene: TC0091     GI: 15834716     BI number: TC0091     GOG: NOG06350     Description: conserved hypothetical protein Gene: TC0090     GI: 15834715     BI number: TC0090     GOG: COG1157     Description: virulence ATPase, putative Gene: TC0089     GI: 15834714     BI number: TC0089     GOG: NOG09595     Description: conserved hypothetical protein Gene: TC0088     GI: 15834713     BI number: TC0088     GOG: COG4284     Description: UDP-N-acetylglucosamine pyrophosphorylase, putative Gene: TC0087     GI: 15834712     BI number: TC0087     GOG: COG0240     Description: glycerol-3-phosphate dehydrogenase, NAD-dependen   c        ta a  a      t  a g  a      t  t at        tg        ag ta        ta       c  a t  t       gc       a  a t  |       tg        tg t  |      t  c       ta ta       a  c       gc at       t  c       ta at       a  t       ta cg       t  t       ta at        at        ta at        at        cg at        cg        cg at        at        cg at        gt        gc                         tcttttaacataaaagcccttttgagcctcttggtcattccggctgcaaaatcttcttcttggcaataaggagaagatttcttcttttccattttctctgcagaatacttaacaggctctacctttgctctattccccgaattatgcgtagagcttttgtaagaatttgcttcatggagaacactgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG1536 Flagellar motor switch protein ... can be seen here [NU] COG1157 Flagellar biosynthesis/type III secretory pathway ATPase ... can be seen here [G] COG4284 UDP-glucose pyrophosphorylase ... can be seen here [C] COG0240 Glycerol-3-phosphate dehydrogenase ... can be seen here     ..................................................................................................................