                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -6.44 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaatcattgtaaatgaaggaaagaaacacgaaattcgtctttttgcagaggctgcagggttgcagttgctagaactgaaaaggattcgtataggaagctt
agtgttgggtgggcttccttatggaaaatatcgagaactgaccgatgcggagttagatagctgtttatcagggaaatcaacagctttagttgcctaaact
agagagcattactctttatagtaaaaaaagaaggaggtctttctccttcttttttttgtttagaggtaaactcgcgatttagggaattttaggagctgtt
ATG

    TC0097 --- TC0098 Gene: TC0097     GI: 15834722     BI number: TC0097     GOG: NOG08100     Description: conserved hypothetical protein Gene: TC0098     GI: 15834723     BI number: TC0098     GOG: COG0340     Description: BirA-related protei   t a  t c  a gc at gc at gt |  t |  a at ta cg at |  a       ct |  a      t  t |  a       gt |  a       gc |  a       at |  a       gc |  a       gc |  g       at |  a       at |  a       gc a  g       at a  g       at ta        at cg        at cg        at gt        at             ttgtttagaggtaaactcgcgatttagggaattttaggagctgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0340 Biotin-(acetyl-CoA carboxylase) ligase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -7.30 kcal/mol Antiterminator: Size=47 nt.     Delta G= -6.44 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case aaatcattgtaaatgaaggaaagaaacacgaaattcgtctttttgcagaggctgcagggttgcagttgctagaactgaaaaggattcgtataggaagctt agtgttgggtgggcttccttatggaaaatatcgagaactgaccgatgcggagttagatagctgtttatcagggaaatcaacagctttagttgcctaaact agagagcattactctttatagtaaaaaaagaaggaggtctttctccttcttttttttgtttagaggtaaactcgcgatttagggaattttaggagctgtt ATG     TC0097 --- TC0098 Gene: TC0097     GI: 15834722     BI number: TC0097     GOG: NOG08100     Description: conserved hypothetical protein Gene: TC0098     GI: 15834723     BI number: TC0098     GOG: COG0340     Description: BirA-related protei   t a  t c  a gc at gc at gt |  t |  a at ta cg at |  a |  a |  a |  a |  a |  a |  a |  g       ct |  a      t  t |  a       gt a  g       gc a  g       at ta        gc cg        gc cg        at gt        at             cttttttttgtttagaggtaaactcgcgatttagggaattttaggagctgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0340 Biotin-(acetyl-CoA carboxylase) ligase ... can be seen here     ..................................................................................................................