                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-21.80 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -4.72 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTCTGGAATATCTTCATGACAGAGTTAAGCAAAGCTTTCTCTCAAGCAGCATCTTTA
GGGGCTTTCAGCGTTGCGGACGTTGCTGCGTTCGCGTCAACCTTGGGATTAGACTCGG
GGACCGTTACCTCAATTGTTGATGGGGAAAGGTGGGCTGAGCTGATCGATGTTGTAAT
TCAGAGCCCTACTATATAAggccactttgttctataggccccctttccccagataggagaaagggggcttttgtattattccgctt
atttgcctccgaggcggatgcaaaataaaagagtaggacgATG

    TC0108 Gene: TC0108     GI: 15834733     BI number: TC0108     GOG: COG1115     Description: sodium/alanine symporter family protei             a           g  t           a  a            cg            cg   t       c  a g  t       cg t  c       ta t  t       ta t  a       ta c  t       cg a  a       cg cg        cg cg        cg gc        cg gc        gc             ttttgtattattccgcttatttgcctccgaggcggatgcaaaataaaagagtaggacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here     ..................................................................................................................