                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=67 nt.     Delta G= -9.53 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agtgcgtataagacaggcttttaagcgtctattagtatacgtgaagaacgataccaggattaGCTTGGTGATAATAGAGAGAGG
GAAACACCTGATACCATTCCGAACTCAGAAGTTAAGCCTCTGATCGCTGATGGTACTA
TACACAAGAGTATGGGAGAGTAGGTCGTTGCCAAGCattttattacagaatatcttagtcacagactaaaaag
aaaagggggtaacagatatctagctgctaccccctttttttgtatcaagacgtttccatcttcttatatagagactctctaccgcTTG

    TC0115 Gene: TC0115     GI: 15834740     BI number: TC0115     GOG: -------     Description: hypothetical protei             c           a  a            cg            ta            gc            at            ta            ta           c  a           t  a           a  a           t  g           a  |           a  | CC       g  | G  A      a  | TA       c  | TG       a  | GC       t  | C  a      t  | T  t      a  | Gt        ta Gt        ta        tc At        ta       a  t Ta        ta       t  a Gt       a  g      a  g At       C  g       gc G  a      G  g       at A  c      A  |       cg G  a      A  |      a  c G  g       Cg        at G  a       Cg        ta Ta        Gt        gc At        Ta        gc Ta        Ta        gc G  |       Gc        gc At       |  a       gc Gc        Cg        at At        Ta        at At        Gt        at                         ttttgtatcaagacgtttccatcttcttatatagagactctctaccgcTTG     ..................................................................................................................