                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:64 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.10 kcal/mol
Antiterminator:    Distance from promoter:31 nt. Size=45 nt.     Delta G= -5.71 kcal/mol
Anti-antiterminator:    Distance from promoter:22 nt.    Size=29 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggata-tatttt. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggatattgggagcgtgttgatatatttttgagaggactttcaaaagaattaatgatctcgctaaaggaaagagactatttttgataaagaatatccgcg
agagcttgggctcaaggggatttttctctctagaaaaaaagctcgaccttatcttggataatcgggtattctcaggccagttttATG

    TC0150 --- fabF --- TC0152 Gene: TC0150     GI: 15834770     BI number: TC0150     GOG: COG0799     Description: conserved hypothetical protein Gene: fabF     GI: 15834771     BI number: TC0151     GOG: COG0304     Description: 3-oxoacyl-(acyl-carrier-protein) synthase II Gene: TC0152     GI: 15834772     BI number: TC0152     GOG: COG0494     Description: mutT/Nudix family protei            at           g  a            ta            ta            tg            ta            ta            at            ta           c  |           a  |           g  |   a       a  | a  g      g  |       tg a  g      a  |      t  g t  a      a  |       cg c  a       at        gc g  a       gc        at cg        gc        gc ta       |  g      a  a cg       |  c      g  a ta       a  g      c  g a  c      a  a      g  g gt       a  g       cg ta        ta        cg at        cg        ta at        gc        at                         ttttctctctagaaaaaaagctcgaccttatcttggataatcgggtattctcaggccagttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0799 Uncharacterized homolog of plant Iojap protein ... can be seen here [IQ] COG0304 3-oxoacyl-(acyl-carrier-protein) synthase ... can be seen here [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here     ..................................................................................................................