                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:89 nt.    Distance to gene:135 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-13.80 kcal/mol
Antiterminator:    Distance from promoter:69 nt. Size=35 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:    Distance from promoter:41 nt.    Size=34 nt.     Delta G= -4.74 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGT-TACGTT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGTACGGGGGAGGAGAAGCCTACGTTTACAGATTAAAGAAAGTATTGCACATTTC
GTAGttcttcacggcaatccttgctctatctagagaaaaGTGTGTTACTTTCAAATTAAGGGGAGAGAAAACA
CGGATGTTTTCTCTTTCTATTTTGGAGAAAGGAAGCTTCTCATCCTCTCTCTTCAAAA
TTTCTCAAGTTTGATGTAGcataggtctgcttaggaccttcggaattgtcataagaaggaaaatattgcgaccatttttttgagcc
aaaggacggttaATG

    lysS Gene: lysS     GI: 15834783     BI number: TC0163     GOG: COG1190     Description: lysyl-tRNA synthetas            TA tc       T  A a  t      A  G ta       A  G       GG cg       A  G      C  A ta        CG        AT cg        TA        CG g  a       TG        AT t  a       TA        AT t  a       CG        AT c  a      |  A       AT c  G      A  A       GC t  T       TA        AT a  G       TA        GC aT        GC        AT cG        TA        GT gT        GC        GT gT        TG        GC                         TATTTTGGAGAAAGGAAGCTTCTCATCCTCTCTCTTCAAAATTTCTCAAGTTTGATGTAGcataggtctgcttaggaccttcggaattgtcataagaaggaaaatattgcgaccatttttttgagccaaaggacggttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1190 Lysyl-tRNA synthetase (class II) ... can be seen here     ..................................................................................................................