                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:87 nt.    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-11.80 kcal/mol
Antiterminator:    Distance from promoter:61 nt. Size=47 nt.     Delta G= -8.96 kcal/mol
Anti-antiterminator:    Distance from promoter:36 nt.    Size=49 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttttat-tatagt. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttttattcccccctagatctagtttagtatagttttctcaatttagagaagattctcgattggggctatccaagggaacagaaggcttgataataatcag
aggctgtaagtaccatggtaggcgcttgctcaaagaagatttctttgtatgtgccgtttttaggccttctggtatagcgcataggaccgtttatccggtt
gagggaaaagaaaagcccctaaggtcttttcaaaggcctttgagctcaaggtaatggagaatagcattttATG

    ctc --- pth Gene: ctc     GI: 15834802     BI number: TC0182     GOG: COG1825     Description: general stress protein Ctc Gene: pth     GI: 15834803     BI number: TC0183     GOG: COG0193     Description: peptidyl-tRNA hydrolas at a  a ta        gg at       t  t gc       a  a ta        cg |  g       cg |  a      a  c        a tg       t  g      g  t cg        gc        at gc        at        at gt        at        gc a  g       tg        at a  t       gc        at g  a      |  t       at a  a      t  c       cg cg       c  a      t  t at       g  a      c  a a  a      g  a      g  t g  |      a  g      t  | gc       g  a      t  | gc       a  a       cg a  a       cg        gt at        ta        cg cg        at        gc cg        at        gc                         gtttttaggccttctggtatagcgcataggaccgtttatccggttgagggaaaagaaaagcccctaaggtcttttcaaaggcctttgagctcaaggtaatggagaatagcattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1825 Ribosomal protein L25 (general stress protein Ctc) ... can be seen here [J] COG0193 Peptidyl-tRNA hydrolase ... can be seen here     ..................................................................................................................