                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G=-13.60 kcal/mol
Antiterminator: Size=53 nt.     Delta G=-15.22 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATATGTACGGTTCAGTAACCGTGAATGATATCATTAGCGTTGCTGATCAAAAAGGTGT
TGTTCTTACACGTAAAAATTTCCCACGCGCTCATAGCGGAGTTAAAACTTTAGGGAAA
CATGTAATTGGATTGAAATTAAAAGAAGGCGTGACTGCGGATCTTCACTTAGAAGTTC
GTGCTGATCACGAAATCGCTGAACAAAAAGAACTCCAAAGCATGGAAGAACAAGAAGA
TTAGacttcttgtttgttaggggggagaatttctttcttccccatctctttttctttaatttttagttATG

    TC0187 Gene: TC0187     GI: 15834807     BI number: TC0187     GOG: COG1947     Description: kinase, GHMP famil TA T  G A  a Gc At At Gc At At Cg At At Gt A  g At Gt G  a        t T  g      t  c A  g      t  t C  g       at G  g       at A  |       gc A  |       at A  |       gt Cg        gc Cg        gc Ta        gc Cg        gc             atctctttttctttaatttttagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1947 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate synthase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:10 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G=-13.60 kcal/mol Antiterminator: Size=53 nt.     Delta G=-15.22 kcal/mol Anti-antiterminator:   Size=20 nt.     Delta G= -6.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATATGTACGGTTCAGTAACCGTGAATGATATCATTAGCGTTGCTGATCAAAAAGGTGT TGTTCTTACACGTAAAAATTTCCCACGCGCTCATAGCGGAGTTAAAACTTTAGGGAAA CATGTAATTGGATTGAAATTAAAAGAAGGCGTGACTGCGGATCTTCACTTAGAAGTTC GTGCTGATCACGAAATCGCTGAACAAAAAGAACTCCAAAGCATGGAAGAACAAGAAGA TTAGacttcttgtttgttaggggggagaatttctttcttccccatctctttttctttaatttttagttATG     TC0187 Gene: TC0187     GI: 15834807     BI number: TC0187     GOG: COG1947     Description: kinase, GHMP famil            tg           t  t           c  t            tt            tg            ct            at            Ga            Ag            Tg            Tg            Ag            Gg           A  g            Aa            Gg           A  a        t           A  a      t  c TA       C  t      t  t T  G      A  t       at A  a      A  t       at Gc       G  |       gc At       A  |       at At       A  |       gt Gc        Gc        gc At        G        gc At        T        gc Cg        A        gc                         atctctttttctttaatttttagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1947 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate synthase ... can be seen here     ..................................................................................................................