                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:108 nt.    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-12.90 kcal/mol
Antiterminator:    Distance from promoter:72 nt. Size=40 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:    Distance from promoter:38 nt.    Size=53 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATC-GATATT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATCGTACAGAAATTTCTTGGATATTAAttttttaaatcaataacttaggctcgcattaaacagttgttggtgcga
gcatttttgtgttttgaaaatggatgcagattatgaaacaagaggtattctagtcagtactcccccgtataggactggggagttatttttttaataagaa
gagatctccctagtgaaataagtacaaaaggggagaaggaggatatgtATG

    TC0205 --- TC0206 Gene: TC0205     GI: 15834825     BI number: TC0205     GOG: COG0814     Description: Mtr/TnaB/TyrO permease family protein Gene: TC0206     GI: 15834826     BI number: TC0206     GOG: COG0670     Description: conserved hypothetical protei   t g  t t  t gt tg ta ta ta ta         g at       a  a cg       a  g g  g       cg a  a       at gt       |  a cg        at gc        at ta        gc |  g      t  |        a |  a       at       t  g |  t       ta       a  g |  t       tg        ta |  a       at        gc |  t       gc       c  t g  g      a  a       cg g  a       cg        cg ta        gt        cg ta        ta        cg gc       |  c       ta ta        at        cg ta        gc        at                         tatttttttaataagaagagatctccctagtgaaataagtacaaaaggggagaaggaggatatgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0814 Amino acid permeases ... can be seen here [R] COG0670 Integral membrane protein, interacts with FtsH ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:142 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-14.20 kcal/mol Antiterminator: Size=69 nt.     Delta G= -7.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACGGTCAAAGAATTCTCCCTGGAGGTAAGGGAGCTTTATTAGTTATGTCAGGACTGGT ACTTGTGAACTTAGTCTTGATCGTACAGAAATTTCTTGGATATTAAttttttaaatcaataactta ggctcgcattaaacagttgttggtgcgagcatttttgtgttttgaaaatggatgcagattatgaaacaagaggtattctagtcagtactcccccgtatag gactggggagttatttttttaataagaagagatctccctagtgaaataagtacaaaaggggagaaggaggatatgtATG     TC0205 --- TC0206 Gene: TC0205     GI: 15834825     BI number: TC0205     GOG: COG0814     Description: Mtr/TnaB/TyrO permease family protein Gene: TC0206     GI: 15834826     BI number: TC0206     GOG: COG0670     Description: conserved hypothetical protei   c g  t g  c a  g t  c t  a ct at aa ta aa ac ca t  | ag at a  t t  | t t t t t        gt |        a  t A         cg A        at T       a  | |         at T        tg A        tg T        at A        cg G         gc G        cg T        ta T        cg C        gc             atttttgtgttttgaaaatggatgcagattatgaaacaagaggtattctagtcagtactcccccgtataggactggggagttatttttttaataagaagagatctccctagtgaaataagtacaaaaggggagaaggaggatatgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0814 Amino acid permeases ... can be seen here [R] COG0670 Integral membrane protein, interacts with FtsH ... can be seen here     ..................................................................................................................