                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTGAATCAGGTCTTGAAGAATGCAAAAGGAGAGAATGTTCTCCTTATGGTTTCTCAA
GGAGAAGTCATTCGATTCGTTGTTTTAAAGTCTGATGAATAGtgcagacttttgttctaaaagatctag
agaaagggggggctcgattgagccccttttctttttataagagaaaaaattagaaagaatatttgtgtggatataagagactcaaccatgtagtctgtct
ttcttattgttaggtagaaatgaagtagaggagtaacagattaactcctccgttgtagaagattgagtgggatATG

    TC0211 Gene: TC0211     GI: 15834831     BI number: TC0211     GOG: COG1026     Description: metalloprotease, insulinase famil AA T  A T  G T  T T  C G  T        g TG       a  a TA       a  t GT       a  c       at CG        at       g  t TA        ta        cg TA        cg        ta AT        ta        cg |  A       tg        gc G  G      g  a       gc C  t       ta        gc T  g       ta        gc T  c       tg        gt A  a       tg       g  | Cg        cg       g  | Ta       a  g       at Gc       g  g       at At       a  g       at At        cg        gc Gt        gc        at                         ttttataagagaaaaaattagaaagaatatttgtgtggatataagagactcaaccatgtagtctgtctttcttattgttaggtagaaatgaagtagaggagtaacagattaactcctccgttgtagaagattgagtgggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1026 Predicted Zn-dependent peptidases, insulinase-like ... can be seen here     ..................................................................................................................