                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:5 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tccaaacgactccgctccagactgctacATGGTACCTATAGATAAGGATTATTATCAAGTATTGCGCCGA
AAACTTCGCTCCTTTTTCCCTCAAAAGAATTCTATAAACTTATTCAAGAGAAGTCTTC
GACAAGAAATTTTTTATTTTCAAATCAATCACAGATAAgtaggtctactctttcataaaaatgactcttggt
atatactcagtgccttccttccatttcggcgccctaagaaaggaggaaaggctgagccttcatgttatagggtgcatagcgttgtattctttttttaggt
GTG

    TC0219 Gene: TC0219     GI: 15834839     BI number: TC0219     GOG: COG0781     Description: N utilization substance protein B, putativ            gc           g  t           a  g           a  a cc       a  g g  c       gc c  t       gc g  a       at g  a       gt cg        gc ta       |  a ta       a  t       gc ta       a  g      a  g a  |       at       t  t cg        gt        at cg       a  a       cg t  |       at        gt ta        ta        ta cg        cg        gt cg        cg        gt ta        cg        gc ta        gt        at                         ttttttaggtGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0781 Transcription termination factor ... can be seen here     ..................................................................................................................