                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:128 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-26.20 kcal/mol
Antiterminator:    Distance from promoter:85 nt. Size=64 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:    Distance from promoter:64 nt.    Size=48 nt.     Delta G=-11.34 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-GATATT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAATTCCTTTCACAGCTAATGATATTCGTTATAGAGGGTATTCTGAATATATTCA
GAAAGTACAAAAATTGGTTGCTCAGCTAATCAATAATGACAGTGTAATTATTCTCTCA
GAGGATGGAAGTTTTTAActgttatgtttatttgtaagttaagtaagggcttttcgactttgtgtcgagaggcccttattttgttta
aaatgttaacgaaaggaggagatagtgcATG

    lytB Gene: lytB     GI: 15834869     BI number: TC0249     GOG: COG0761     Description: penicillin tolerance protein Lyt            ta           t  t           t  t            gt            tg            at            ta            ta           |  g           |  t GA       |  t A  G      g  a CG        ta TA        cg C  T      A  |        t TG        At       t  g CG        Ta       t  t TA        Ta        cg TA        Tg        at A  G       Tg        gc T  T       Tg        cg T  T       Gc        ta A  T       At        tg A  T       At        ta T  T       Gt        tg G  A       Gt        cg TA       T  c       gc Gc       A  g       gc At       G  a       gc Cg        Gc        at At        At        at Gt        Gt        ta Ta        At        gt At        Cg        at                         ttgtttaaaatgttaacgaaaggaggagatagtgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IM] COG0761 Penicillin tolerance protein ... can be seen here     ..................................................................................................................