                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -9.40 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTTCTTGAAACGATACAGTGGCGTTAAGCAGATGGCTCCTAAGCCTGAAACTTCTGT
AGAAGAAGTTCTTCCAAAAGGTAAGAAAAAAGCTCCTGCTAAAAAGAAAAAGTAGtgtc
tgttaaagacttcttttgagttatggagaagagcggggatgttccccgctttttttttgcttcaagaggaagtctcgtagtttgaagttgtctcttctgt
caaagtctagtgttccccaaaattgattgccaatgtacactctgatctttgtttgaaagacaccagagtagaagaagtcgttcATG

    prfA --- TC0293 --- ffh --- rpsP --- trmD --- rplS Gene: prfA     GI: 15834912     BI number: TC0292     GOG: COG0216     Description: peptide chain release factor 1 Gene: TC0293     GI: 15834913     BI number: TC0293     GOG: COG2890     Description: modification methylase, HemK family Gene: ffh     GI: 15834914     BI number: TC0294     GOG: COG0541     Description: signal recognition particle Gene: rpsP     GI: 15834915     BI number: TC0295     GOG: COG0228     Description: ribosomal protein S16 Gene: trmD     GI: 15834916     BI number: TC0296     GOG: COG0336     Description: tRNA (guanine-N1)-methyltransferase Gene: rplS     GI: 15834917     BI number: TC0297     GOG: COG0335     Description: ribosomal protein L1            gt           a  t           g  a           t  t            tg            tg            ta            cg            ta   t        ta t  a       cg g  a      a  | ta       g  |        g cg       a  |      t  t ta       a  |      a  t gc       a  |       gc t  t       ta        gc G  t       tg        gc A  |       gc        gc T  |       tg        cg Gc        cg        gc At        tg        at At       g  g       gt At        ta        at At        Gt        at                         tttttgcttcaagaggaagtctcgtagtttgaagttgtctcttctgtcaaagtctagtgttccccaaaattgattgccaatgtacactctgatctttgtttgaaagacaccagagtagaagaagtcgttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0216 Protein chain release factor A ... can be seen here [J] COG2890 Methylase of polypeptide chain release factors ... can be seen here [U] COG0541 Signal recognition particle GTPase ... can be seen here [J] COG0228 Ribosomal protein S16 ... can be seen here [J] COG0336 tRNA-(guanine-N1)-methyltransferase ... can be seen here [J] COG0335 Ribosomal protein L19 ... can be seen here     ..................................................................................................................