Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:71 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -8.00 kcal/mol
Antiterminator:    Distance from promoter:40 nt. Size=44 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtca-tatttt. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtcacaggatattttttttagttattttctgcaatactctatagagaatacttgtgttcacgaaaaaatcagtcctagtgtacagtcttcgaagaaga
cgaagaggttctgaatgaacagcttcttcttttgagtagggtaattcgcaggaagtaagttttaatagacaaggGTG

    ssb


Gene: ssb     GI: 15834934     BI number: TC0314     GOG: COG0629     Description: single-strand binding protei


  a
g  a
 cg
 ta
 ta
 cg
 ta
 gc
a  g
c  a
a  a
t  g
g  |        a
t  |      g  a
g  |      t  t
a  |       cg
 ta        ta
 cg        ta
 cg        gc
|  t      g  a
t  t      a  g
 gc        gc
 at        at
 cg        at
 ta        gc
            ttcttttgagtagggtaattcgcaggaagtaagttttaatagacaaggGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0629 Single-stranded DNA-binding protein ... can be seen here

    ..................................................................................................................