                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=76 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -5.66 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGTTTTCTTGAAGACAATCCAGTAGCGTGGGCACATTTGGATATTGCTGGTACCGC
TTACCATGAAAAAGAAGAGCTTCCTTATCCTAAATATGCAACAGGATTTGGTGTTCGT
TGTTTAATTTATTATATGAACAAGTTTTTATCTAAATAGttcttgtttaggtttgtcaaaataaaaagatt
tggttggtttttaatttttttattaaaaaccaaccttttttattaaagtttttcattcttcctgtcgatagatcaaataagtggtagttacctgtctaat
taggggaatgaacATG

    hctB Gene: hctB     GI: 15834936     BI number: TC0316     GOG: NOG06624     Description: Hc2 nucleoprotei             t           t  c            Gt            At            Tg            At            At            At            Ta            Cg            Tg            At           |  t           |  t           |  g           |  t           |  c           |  a           |  a           |  a   T       |  a A  T      |  t A  T      |  a T  A      |  a T  T       Ta T  T       Ta G  A       Ta T  T       Tg TA        Ta GT        Gt        tt CG        At       t  t TA        At       t  t TA       |  g       ta GC        Cg        at TA        At        at |  A       At        ta |  G      G  g       ta |  T       Tg        ta G  T       At        ta G  T      |  t       ta T  T      |  t       gc T  T      T  t       gc TA        At        ta AT        Ta        ta GC        Ta        gc GT        At        gc                         ttttttattaaagtttttcattcttcctgtcgatagatcaaataagtggtagttacctgtctaattaggggaatgaacATG     ..................................................................................................................