                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=15 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-12.51 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAAAAAACATAAACATACTGCAGCTTGCGGACGTGTAGCTGCTTCTGGAGTAAAAGT
TTGTGCTTCCTCTGCTAAGAGAAGAACACATCATAATCGTTCTCGTACAGCTCATAGT
TGGCGTCAGCAATTAATGAAGCTTGTTGCTAAATAGcaattgctgtttccaatctggagtaaccgggaaaaag
aatgctcttttcccggttttttatatttattggctgagttgaaatagctagtatggctagaatcttagagcaagaggaatgatcctaatgggttgagttc
aggcattgcttATG

    TC0317 Gene: TC0317     GI: 15834937     BI number: TC0317     GOG: COG1466     Description: conserved hypothetical protei AA A  T TA CG Gc Ta Ta Gt T  t T  | Cg Gc At A  g G  t                 tg T  t                a  c A  t                 at A  c                 gc T  c                a  | T  a                 at A  a                 at A  t                 at C  |        t        at Gc       g  a       gc At       a  a       gc Cg        gc        gc T  g       gc        cg G  a       tg        cg Cg        cg        at Gt        tg        at                         ttttatatttattggctgagttgaaatagctagtatggctagaatcttagagcaagaggaatgatcctaatgggttgagttcaggcattgcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1466 DNA polymerase III, delta subunit ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.60 kcal/mol Antiterminator: Size=15 nt.     Delta G= -3.30 kcal/mol Anti-antiterminator:   Size=46 nt.     Delta G= -8.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGAAAAAACATAAACATACTGCAGCTTGCGGACGTGTAGCTGCTTCTGGAGTAAAAGT TTGTGCTTCCTCTGCTAAGAGAAGAACACATCATAATCGTTCTCGTACAGCTCATAGT TGGCGTCAGCAATTAATGAAGCTTGTTGCTAAATAGcaattgctgtttccaatctggagtaaccgggaaaaag aatgctcttttcccggttttttatatttattggctgagttgaaatagctagtatggctagaatcttagagcaagaggaatgatcctaatgggttgagttc aggcattgcttATG     TC0317 Gene: TC0317     GI: 15834937     BI number: TC0317     GOG: COG1466     Description: conserved hypothetical protei AT A  T C  A G  A AT CG TA G  A CG GC                  tg GT                 a  c |  T                 at |  G                 gc |  T                a  | T  T                 at TG                  at GC                  at AT         G        at TA       A  c       gc |  A      T  a       gc A  A       Aa        gc C  T       At        cg TA        At        cg CG        Tg        at Gc        Cc        at                         ttttatatttattggctgagttgaaatagctagtatggctagaatcttagagcaagaggaatgatcctaatgggttgagttcaggcattgcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1466 DNA polymerase III, delta subunit ... can be seen here     ..................................................................................................................