                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:116 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G=-21.40 kcal/mol
Antiterminator: Size=59 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTAGCTGCTTCAGCTGCTAAAGAACAAGAGCTGGCAGAGGCCACAGCAGCAGCTGA
GAAGGAAGCTTCTCCTGCAGCGAAAGAAGTCTCTCCTGCTATAGAGGGTGTTTCCTAA
catcatttttctagaaactttctagtaaaaagagggccccgcttattttgagcggggcttttcttttgtctttaaaatctcttttcttcacaaatctctt
ctaatctcctactatttttctctagatagacaactatcaattccgttaacatatccttttcaaagcagaaattcggtcacaaacTTG

    lepA Gene: lepA     GI: 15834954     BI number: TC0334     GOG: COG0481     Description: GTP-binding protein Lep             c           a  t            at            at            gc            at            ta            cg           |  t            ta            ta            ta            ta            ta           a  g           c  |           t  |           a  | CC       c  | T  T      A  |        t TA       A  |      t  t TA        Ta       a  t Gc        Cg        tg Ta        Cg        ta Gt       T  |       cg Gc       T  |       gc |  a       Tg        cg |  t       Gc        cg |  t      T  |       cg |  t       Gc        cg Gt        Gc        gc At        Gc        gt Gc       A  g       gt At        Gc        at Ta        At        gt                         cttttgtctttaaaatctcttttcttcacaaatctcttctaatctcctactatttttctctagatagacaactatcaattccgttaacatatccttttcaaagcagaaattcggtcacaaacTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0481 Membrane GTPase LepA ... can be seen here     ..................................................................................................................