                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:73 nt.    Distance to gene:68 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G= -7.60 kcal/mol
Antiterminator:    Distance from promoter:54 nt. Size=33 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:12 nt.    Size=49 nt.     Delta G= -8.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcaa-tagaag. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcaataaggtggttgcgtttttagaagaaagatcttcgtgtaacatgttgttttctttgtaaaaagatatggaagggagatgtgtaacccgattgtaa
taagccgggattgagcggcagaggaccggttagtttttagtggctttaaaggaaatagcgaggaactttcagacttagtttctcgcatcaatggtcagga
ggctctATG

    TC0338 --- TC0339 --- TC0341 --- TC0342 --- dxr Gene: TC0338     GI: 15834958     BI number: TC0338     GOG: COG0803     Description: ABC transporter, periplasmic substrate-binding protein, putative Gene: TC0339     GI: 15834959     BI number: TC0339     GOG: COG1121     Description: ABC transporter, ATP-binding protein Gene: TC0341     GI: 15834960     BI number: TC0341     GOG: COG1108,COG1321     Description: ABC transporter, permease protein, putative Gene: TC0342     GI: 15834961     BI number: TC0342     GOG: COG1108     Description: ABC transporter, permease protein, putative Gene: dxr     GI: 15834962     BI number: TC0343     GOG: COG0743     Description: 1-deoxy-D-xylulose 5-phosphate reductoisomeras aa a  a a  g ta gt ta t  t tg cg        aa ta       t  t ta       g  a        g tg        ta       c  g tg        tg       g  c |  g      a  c      a  a g  a       gc       g  g tg        cg        ta ta        cg        tg gt        cg       a  g tg       |  a      g  a at        at        gc cg        at        gc at        tg        cg a  a      g  a       cg ta        tg        gt gc        gc        at                         agtttttagtggctttaaaggaaatagcgaggaactttcagacttagtttctcgcatcaatggtcaggaggctctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0803 ABC-type metal ion transport system, periplasmic component/surface adhesin ... can be seen here [P] COG1121 ABC-type Mn/Zn transport systems, ATPase component ... can be seen here [P] COG1108 ABC-type Mn2+/Zn2+ transport systems, permease components ... can be seen here [K] COG1321 Mn-dependent transcriptional regulator ... can be seen here [P] COG1108 ABC-type Mn2+/Zn2+ transport systems, permease components ... can be seen here [I] COG0743 1-deoxy-D-xylulose 5-phosphate reductoisomerase ... can be seen here     ..................................................................................................................