                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-13.66 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCAAAGACCGCTTAGTAATAATGATCTCCAAAGTCTTTATTACTGAGCGGTTAGGCA
TGAGTGCCTACTTGGGGCTACAGAGATGCACTTTATTGCATCTACCCGCTTTTCTTTG
CTGTCAGACCTATTTTTTTGGTTTTTTTCGCAAGGCTTCACTGCCTTGCGTTTTTTTT
GTCCAAATGTTTTTCTATTATGAATTGATTTAAaactcaatgtattttgttttgttttataattaactgtttcagt
ttaaaattattgttaccattcactggctttttattttttaaggaaatagcATG

    TC0355 --- TC0356 Gene: TC0355     GI: 15834974     BI number: TC0355     GOG: NOG04986     Description: conserved hypothetical protein Gene: TC0356     GI: 15834975     BI number: TC0356     GOG: NOG07053     Description: conserved hypothetical protei TT T  A C  T AT CG GC TA AT GC AT |  A |  C |  C |  C |  G |  C |  T        T |  T      T  T |  T      T  T |  T      A  T |  C      T  T |  T       CG |  T       CG |  T       AT |  G       GT GC        AT AT       |  T       CA CG       C  T      T  C AT       T  T      T  T |  C      G  T       CG TA       T  C       GC CG        CG        GC G  A       GC        AT GC        TA        AT GC        TA        CG GT        TG        GC TA        CG        CG                         TTTTTTTTGTCCAAATGTTTTTCTATTATGAATTGATTTAAaactcaatgtattttgttttgttttataattaactgtttcagtttaaaattattgttaccattcactggctttttattttttaaggaaatagcATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-14.20 kcal/mol Antiterminator: Size=40 nt.     Delta G= -8.50 kcal/mol Anti-antiterminator:   Size=64 nt.     Delta G=-22.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTCAAAGACCGCTTAGTAATAATGATCTCCAAAGTCTTTATTACTGAGCGGTTAGGCA TGAGTGCCTACTTGGGGCTACAGAGATGCACTTTATTGCATCTACCCGCTTTTCTTTG CTGTCAGACCTATTTTTTTGGTTTTTTTCGCAAGGCTTCACTGCCTTGCGTTTTTTTT GTCCAAATGTTTTTCTATTATGAATTGATTTAAaactcaatgtattttgttttgttttataattaactgtttcagt ttaaaattattgttaccattcactggctttttattttttaaggaaatagcATG     TC0355 --- TC0356 Gene: TC0355     GI: 15834974     BI number: TC0355     GOG: NOG04986     Description: conserved hypothetical protein Gene: TC0356     GI: 15834975     BI number: TC0356     GOG: NOG07053     Description: conserved hypothetical protei GC G  T G  A GC TA TG C  A A  G T  A C  T CG GC TA GC         C AT       C  T GT       A  A |  T      G  T |  A      A  T T  T       CT AT        TT CG        GT GC        TT |  A       CT |  T      |  G       CA GC       G  G      T  C AT       T  T      T  T TA       T  T       CG T  C      T  T       GC GC        CT        GC GC        TT        AT CG        TT        AT GC        TT        CG AT        TC        GC GT        CG        CG                         TTTTTTTTGTCCAAATGTTTTTCTATTATGAATTGATTTAAaactcaatgtattttgttttgttttataattaactgtttcagtttaaaattattgttaccattcactggctttttattttttaaggaaatagcATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:186 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-11.70 kcal/mol Antiterminator: Size=38 nt.     Delta G=-11.90 kcal/mol Anti-antiterminator:   Size=47 nt.     Delta G=-23.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTCAAAGACCGCTTAGTAATAATGATCTCCAAAGTCTTTATTACTGAGCGGTTAGGCA TGAGTGCCTACTTGGGGCTACAGAGATGCACTTTATTGCATCTACCCGCTTTTCTTTG CTGTCAGACCTATTTTTTTGGTTTTTTTCGCAAGGCTTCACTGCCTTGCGTTTTTTTT GTCCAAATGTTTTTCTATTATGAATTGATTTAAaactcaatgtattttgttttgttttataattaactgtttcagt ttaaaattattgttaccattcactggctttttattttttaaggaaatagcATG     TC0355 --- TC0356 Gene: TC0355     GI: 15834974     BI number: TC0355     GOG: NOG04986     Description: conserved hypothetical protein Gene: TC0356     GI: 15834975     BI number: TC0356     GOG: NOG07053     Description: conserved hypothetical protei   C C  A T  A       GA C  A      T  G       TT TG        AT       T  A AT        CG       C  T GC        GC        AT T  T       GC        CG AT        AT        GC AT       T  |       TA TA        TA        AT AT        GC        GC AT        GT        AT TA       |  T      G  A GC       |  G      A  | AT       |  G      C  | TG       |  G      A  | TA        CG       T  | CG        GC       C  | GC        AT       G  | CG       |  A       GC CG        GC        GC AT        TA        GC GT        CG        TG                         CTTTTCTTTGCTGTCAGACCTATTTTTTTGGTTTTTTTCGCAAGGCTTCACTGCCTTGCGTTTTTTTTGTCCAAATGTTTTTCTATTATGAATTGATTTAAaactcaatgtattttgttttgttttataattaactgtttcagtttaaaattattgttaccattcactggctttttattttttaaggaaatagcATG     ..................................................................................................................