                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:57 nt.    Distance to gene:82 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G= -8.60 kcal/mol
Antiterminator:    Distance from promoter:29 nt. Size=45 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-tagatt. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGTTAGCAGAAGGTGACTAAtagattttttagttgcctagatatttatagccagtaaaaaaatgctgttgttttagag
acaaaagagaagagattttttttgaatttttcttttctaaattctttagaaggcaaatagtgctgctttttgtttggaaaaaataatcatcaaaattata
atcattccctctgataaggtgatttaagttATG

    accC --- rplM Gene: rplM     GI: 15835020     BI number: TC0401     GOG: COG0102     Description: ribosomal protein L13 Gene: rpsI     GI: 15835021     BI number: TC0402     GOG: COG0103     Description: ribosomal protein S at t  t a  t g  a       ga at       a  c ta       g  a cg       a  a c  c       ta gc        ta ta        tg         t tg        ta       t  t g  t      g  g       tg a  a       ta        ta ta        ta        ta ta       g  g      t  t ta        ta       t  t ta        cg        at ta       g  |       gt ta        ta        at at        at        gc |  g       at        at gc        at        at at        at        gt tg        at        at At        at        gc At        at        at                         aaattctttagaaggcaaatagtgctgctttttgtttggaaaaaataatcatcaaaattataatcattccctctgataaggtgatttaagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0102 Ribosomal protein L13 ... can be seen here [J] COG0103 Ribosomal protein S9 ... can be seen here     ..................................................................................................................