                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=20 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGTGTGCAGCTACTTACTATGCGACTTCAATGGGATATTTCCAGCTGATTGTGGAA
CAACGAAACTTCCGGGTTGCTTCTTTTTCTTGGAATGTTGTTCGCTTGCCATTTGTTC
CATAAcaaaggttctttgcttatgccgcttggctagccgttagttaagcggttctttttagtaaaataaaacaaggaatcttttgttgtagactgat
cgaaaagctacaagtatagtactaggaagagaaggcacttagtaggctcagtcaaagaacttcgaaacaggtataagggtcccaaaaATG

    TC0422 --- lig Gene: TC0422     GI: 15835040     BI number: TC0422     GOG: COG0515,COG1262     Description: conserved hypothetical protein Gene: lig     GI: 15835041     BI number: TC0423     GOG: COG0272     Description: DNA ligas CA C  T TA TA Gc Ta Ta Ta A  | Cg Cg Gt T  t T  c C  t                  c G  t                c  g C  t                 gt T  |                 at Tg        ct        ta Gc       g  t       cg T  t       cg        gt T  |       cg        gt Gt        gc        ta Ta       t  t       ta At       a  |       cg A  g      t  |       gc Gc        ta        cg Gc        cg        cg Tg        gc        gt                         tctttttagtaaaataaaacaaggaatcttttgttgtagactgatcgaaaagctacaagtatagtactaggaagagaaggcacttagtaggctcagtcaaagaacttcgaaacaggtataagggtcccaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [RTKL] COG0515 Serine/threonine protein kinase ... can be seen here [S] COG1262 Uncharacterized conserved protein ... can be seen here [L] COG0272 NAD-dependent DNA ligase (contains BRCT domain type II) ... can be seen here     ..................................................................................................................