                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=12 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -7.89 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTGCAAGAAAACACACAACCTGTGAAACGTTCTAGAGAAGAAGAGGAAGATCCTCT
AGAAGGAACTTCGACTAGTCAAGAAGATCTTTCTCCTCCGACTAAAAAGAGAAGAATT
CAGTGAattctgtaatctcaaaaaagggatcccttgttaaggcgatccttttttgataaaagatattttcctgcggcagatactctcccttaccac
catgtaatatcttttctatttctttgcttttcttaaaaagataatcttttcattatgagctgtcttattatttaatcggagccctctaATG

    TC0431 Gene: TC0431     GI: 15835049     BI number: TC0431     GOG: NOG04877     Description: MAC/perforin family protei   G A  T CG TA Ta At At Gc At |  g |  t A  a G  a At Gc                   t At                 g  t A  c                 ta A  a                 ta A  a                 cg A  a                 cg T  a                |  c C  a       at        cg A  a      g  c       ta G  g       gc        at Cg        gc        gc Cg        at        gc Ta        at        gt                         tttttgataaaagatattttcctgcggcagatactctcccttaccaccatgtaatatcttttctatttctttgcttttcttaaaaagataatcttttcattatgagctgtcttattatttaatcggagccctctaATG     ..................................................................................................................