                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=65 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATTAGGAGCTTCATTAACTGCAACAACTCTAGGCGTCCTTTCTCCTTTCTTTTTTGC
AAAAATTGGCGTGGATCCAGCTTTGGCCTCAGGCCCGATTGTTACGGCTCTTAACGAT
ATTATGTCGATGGTCATTTTCCTGCTAATTACAGGCACTTTAAACGTTTTGTTCTTCA
AATAAtccgttagtccgaagataaaactttcttcggactttttttctatcccttttctttatctctctttaaaatagttcatgaattttgaagagtt
tggaatttacttagaatagaggttggtttGTG

    TC0463 Gene: tgt     GI: 15835083     BI number: TC0465     GOG: COG0343     Description: queuine tRNA-ribosyltransferas             T           T  C           C  A            TA            TA            GT            TA            TA           T  t           T  c   A        Gc A  T       Cg T  T       At C  A       At GC       A  | TA       T  | CG       T  | CG        Ta T  C       Cg T  |       At T  |      C  | T  |       Gc A  |       Gc C  |      A  | TA       C  | GC       A  | GT       T  | T  T      T  | A  T      A  | G  A      A  | C  A      T  |       aa TA       C  |      a  c GC       G  |      a  t TG       T  |      t  t AT       C  |       at T  T       Cg        gc T  T       Ta        at AT        Ta        at TG        Tg        gc AT        Ta        cg GT        At        cg                         actttttttctatcccttttctttatctctctttaaaatagttcatgaattttgaagagtttggaatttacttagaatagaggttggtttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0343 Queuine/archaeosine tRNA-ribosyltransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.20 kcal/mol Antiterminator: Size=65 nt.     Delta G= -7.20 kcal/mol Anti-antiterminator:   Size=36 nt.     Delta G= -4.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TATTAGGAGCTTCATTAACTGCAACAACTCTAGGCGTCCTTTCTCCTTTCTTTTTTGC AAAAATTGGCGTGGATCCAGCTTTGGCCTCAGGCCCGATTGTTACGGCTCTTAACGAT ATTATGTCGATGGTCATTTTCCTGCTAATTACAGGCACTTTAAACGTTTTGTTCTTCA AATAAtccgttagtccgaagataaaactttcttcggactttttttctatcccttttctttatctctctttaaaatagttcatgaattttgaagagtt tggaatttacttagaatagaggttggtttGTG     TC0463 Gene: tgt     GI: 15835083     BI number: TC0465     GOG: COG0343     Description: queuine tRNA-ribosyltransferas             c           c  g           t  a            ga            ag            ta            tt            ga           c  a           c  a            t            A            A            T           A  |           A  |           A  |            C            T            T           C  |   T        T T  C       T C  A      G  | TA       T  | TA       T  | GT       T  | TA       T  |       aa TA       G  |      a  c T  t      C  |      a  t T  c      A  |      t  t Gc       A  |       at Cg       A  |       gc At       T  |       at At       T  |       at A  |       T        gc T  |       C        cg T  |       A        cg Ta        C        ta Cg        G        gc At        G        at                         ttttttctatcccttttctttatctctctttaaaatagttcatgaattttgaagagtttggaatttacttagaatagaggttggtttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0343 Queuine/archaeosine tRNA-ribosyltransferase ... can be seen here     ..................................................................................................................