                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:12 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=78 nt.     Delta G=-15.90 kcal/mol
Anti-antiterminator:   Size=64 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACCTTTTTGCCATCTTCAGAAAGAAAATTATTAGAGAAAGTACTATCCATATTTGTG
TTAGGCCTATACGTCAGGGGGATGTTCTCTGTTGGACAAGTAGAGCAGTTAGCAAAAA
TTTGTAATGCCAAGGATTCCACTTGCTTTGCTCGTCTAGTAAATAATTTTTCTTTAAT
AAGAACAGCTTTGCCAACATTGTTTAATTAAgccttgataaagatttgaatgaatcctaaataaattgtaggattcc
ttgtttaaggaagggaacagatcccttcctaggttgtttcgagaggcttATG

    rpiA --- TC0484 --- TC0483 Gene: rpiA     GI: 15835103     BI number: TC0485     GOG: COG0120     Description: ribose 5-phosphate isomerase Gene: TC0484     GI: 15835102     BI number: TC0484     GOG: COG1259     Description: conserved hypothetical protein Gene: TC0483     GI: 15835101     BI number: TC0483     GOG: COG1678     Description: transcriptional regulator, putativ             a           a  a           t  t           a  t           a  g            at            ta            cg            cg   T        ta A  T       at CG        at AT        gc AT       t  | |  T      a  | C  A      a  | C  A      g  | G  T      t  | T  T      t  | TA       t  | TA       a  | Cg        gc Gc        at A  |       at C  |      a  g        a A  |      t  t      c  g A  |       at       a  a Gc        gt        at At        ta        gc At        ta        gc Tg        cg        gc A  a       cg        at At       g  a       at Ta       A  a       gc Ta       A  g       gc Ta       T  g       at Cg       T  |      a  | Ta       A  |      t  | |  t      A  |      t  | |  t       Tg       t  | T  t       Ta       g  | Tg        Ta       t  | Ta        Gc        ta Ta        Ta        cg At        Tg        cg                         ttgtttcgagaggcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0120 Ribose 5-phosphate isomerase ... can be seen here [S] COG1259 Uncharacterized conserved protein ... can be seen here [K] COG1678 Putative transcriptional regulator ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:44 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -7.40 kcal/mol Antiterminator: Size=34 nt.     Delta G= -4.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GACCTTTTTGCCATCTTCAGAAAGAAAATTATTAGAGAAAGTACTATCCATATTTGTG TTAGGCCTATACGTCAGGGGGATGTTCTCTGTTGGACAAGTAGAGCAGTTAGCAAAAA TTTGTAATGCCAAGGATTCCACTTGCTTTGCTCGTCTAGTAAATAATTTTTCTTTAAT AAGAACAGCTTTGCCAACATTGTTTAATTAAgccttgataaagatttgaatgaatcctaaataaattgtaggattcc ttgtttaaggaagggaacagatcccttcctaggttgtttcgagaggcttATG     rpiA --- TC0484 --- TC0483 Gene: rpiA     GI: 15835103     BI number: TC0485     GOG: COG0120     Description: ribose 5-phosphate isomerase Gene: TC0484     GI: 15835102     BI number: TC0484     GOG: COG1259     Description: conserved hypothetical protein Gene: TC0483     GI: 15835101     BI number: TC0483     GOG: COG1678     Description: transcriptional regulator, putativ at g  a ta ta cg         a c  a      a  a g  t      t  t At       a  t At       a  g Tg        at Ta        ta A  a       cg At        cg Tg        ta Ta        at Ta        at Gt        gc             cttgtttaaggaagggaacagatcccttcctaggttgtttcgagaggcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0120 Ribose 5-phosphate isomerase ... can be seen here [S] COG1259 Uncharacterized conserved protein ... can be seen here [K] COG1678 Putative transcriptional regulator ... can be seen here     ..................................................................................................................