                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:135 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATAAGGTGTCTGAAGATCTTTCTGACGAATACTTAGCCTTAGCCAATAACTATATTA
CTGCTGTCCCACTAATTTCCAAAAACACTCCTTTGGCAACACTTTCTGAAGAAGAACT
AGCCTTCCTTAAAGAATCCTTTGAACAATCTGTTCAATGGGATTCTTCTTTAAATTTC
GAAGAAGATCTAGCTTAAacttacgaatgcgttgaaactatagtttcaacgcattttccccctggtctataatacatcctatcctaa
tatcttattcagtccgcaacctgaaaatcaaaagagtttATG

    ubiA --- ubiX Gene: ubiA     GI: 15835110     BI number: TC0492     GOG: COG0382     Description: 4-hydroxybenzoate octaprenyltransferase Gene: ubiX     GI: 15835111     BI number: TC0493     GOG: COG0163     Description: phenylacrylic acid decarboxylas   T         T C  A      A  C A  G      A  T A  C       CG GC        AT AT        AT AT        GC GC        TA |  C       TA |  T      |  T A  T       TG A  A       CG G  A       CG TA        TA CG        AT TA        AT TA        GC             TTCTTTAAATTTCGAAGAAGATCTAGCTTAAacttacgaatgcgttgaaactatagtttcaacgcattttccccctggtctataatacatcctatcctaatatcttattcagtccgcaacctgaaaatcaaaagagtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0382 4-hydroxybenzoate polyprenyltransferase and related prenyltransferases ... can be seen here [H] COG0163 3-polyprenyl-4-hydroxybenzoate decarboxylase ... can be seen here     ..................................................................................................................